|
New England Biolabs
dtale gene specific primer dtale gsp r0 cgacttgagcagcaggagatgc Dtale Gene Specific Primer Dtale Gsp R0 Cgacttgagcagcaggagatgc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/bio_rxiv__2022__05__11__491484-94-11-25 Average 86 stars, based on 1 article reviews
dtale gene specific primer dtale gsp r0 cgacttgagcagcaggagatgc - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
gene-specific primer (gsp) of the sinsyn7 gene Gene Specific Primer (Gsp) Of The Sinsyn7 Gene, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/gene+specific+primer++gsp++of+the+sinsyn7+gene/pm40632784-63-9-1 Average 90 stars, based on 1 article reviews
gene-specific primer (gsp) of the sinsyn7 gene - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
gene-specific primers (gsps) Gene Specific Primers (Gsps), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/gene+specific+primers/pm39225157-47-16-0 Average 90 stars, based on 1 article reviews
gene-specific primers (gsps) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
AgriScience Labs
gene-specific primers (gsps) Gene Specific Primers (Gsps), supplied by AgriScience Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/gene+specific+primers++gsps+/pm37737036-131-21-27 Average 90 stars, based on 1 article reviews
gene-specific primers (gsps) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
gene-specific primers (gsps) Gene Specific Primers (Gsps), supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/gene+specific+primers/pmc10582272-78-6-19 Average 90 stars, based on 1 article reviews
gene-specific primers (gsps) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
gene specific primer (gsp) pool kit Gene Specific Primer (Gsp) Pool Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/gene+specific+primers/pm34651371-36-63-53 Average 90 stars, based on 1 article reviews
gene specific primer (gsp) pool kit - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
ngs panel custom-designed gene-specific primer (gsp) pool kit Ngs Panel Custom Designed Gene Specific Primer (Gsp) Pool Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene-specific+primers+(gsps/ngs+panel+custom+designed+gene+specific+primer++gsp++pool+kit/pmc08232338-35-32-29 Average 90 stars, based on 1 article reviews
ngs panel custom-designed gene-specific primer (gsp) pool kit - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |